لاکتوباسیل های مقاوم جدا شده از پنیرهای محلی مناطق روستایی کردستان و کاربرد آن در سلنیت زدایی از آب و پساب

نوع مقاله: مقاله پژوهشی

نویسندگان

1 استادیار میکروبیولوژی، عضو هیات علمی دانشگاه کردستان، دانشکده علوم، گروه علوم زیستی، سنندج، ایران * (مسوول مکاتبات).

2 دانشجوی کارشناسی ارشد زیست شناسی سلولی- مولکولی، دانشگاه کردستان، دانشکده علوم، گروه علوم زیستی، سنندج.

چکیده

زمینه و هدف: حضور تراکم های بالای سلنیت در پساب‌های صنعتی و ورود آن به منابع آب و زنجیره غذایی موجب نگرانی های بهداشتی می شود. بنابراین حذف این آلاینده‌ سمی با روش‌های امن هم چون اصلاح زیستی میکروبی امری ضروری می‌باشد. هدف از این مطالعه، بررسی توانایی حذف سلنیت در لاکتوباسیل های مقاوم جدا شده از پنیرهای سنتی مناطق بکر روستایی استان کردستان است.
روش بررسی: 25 نمونه پنیر محلی از مناطق بکر روستایی استان کردستان جمع آوری شد. غنی سازی در محیط های کشت MRS حاوی سلنیت انجام گرفت. الگوی تحمل پذیری سویه های جدا شده نسبت به سلنیت، به وسیله روش های رقیق سازی مایع و رقت در آگار بررسی شد. میزان سلنیت موجود در محیط های واکنش با روش کالری متریک ارزیابی گردید. از روش تک عاملی برای بهینه سازی حذف استفاده شد. شناسایی ملکولی با تکثیر ژن 16S rRNA و تعیین توالی انجام گرفت.
 یافته ها: از مجموع 30 سویه باکتری مقاوم جدا شده، Lactobacillus sp. Tra cheese 6 بالاترین مقاومت توام با احیای سلنیت به سلنیوم عنصری (125 میلی مولار) را نشان داد. بیشترین میزان حذف میکروبی سلنیت در غلظت بیومس 50 گرم در لیتر، غلظت کلرید سدیم 4 درصد، دمای 37 درجه سانتی گراد، pH  برابر 2/7، دور هم زن rpm 100 و میزان سلنیت 45 میلی مولار مشاهده شد. تحت شرایط بهینه شده، پس از 60 ساعت میزان یون سلنیت در سوپرناتانت از 45 میلی مولار به حدود 8/1 میلی مولار رسید که تقریبا 96 درصد حذف شد.
بحث و نتیجه گیری: با توجه به  یافته های به دست آمده در این مطالعه، جداسازی و تعیین خصوصیت لاکتوباسیلوس ها را می توان به عنوان کاتالیست های ایمن و اقتصادی و جایگزین مناسب روش های فیزیکوشیمیایی برای حذف فلزات و اکسی آنیون های سمی در صنعت آب و پساب پیشنهاد نمود

کلیدواژه‌ها


 

 

 

 

 

علوم و تکنولوژی محیط زیست، دورهنوزدهم، شماره یک، بهار 96

 

لاکتوباسیل های مقاوم جدا شده از پنیرهای  محلی مناطق روستایی کردستان و کاربرد آن در سلنیت زدایی از آب و پساب

 

مراحم آشنگرف [1]*

m.ashengroph@uok.ac.ir  

داود صاعدی [2]

 

تاریخ دریافت:2/5/93

تاریخ پذیرش:18/5/94

 

چکیده

زمینه و هدف: حضور تراکم های بالای سلنیت در پساب‌های صنعتی و ورود آن به منابع آب و زنجیره غذایی موجب نگرانی های بهداشتی می شود. بنابراین حذف این آلاینده‌ سمی با روش‌های امن هم چون اصلاح زیستی میکروبی امری ضروری می‌باشد. هدف از این مطالعه، بررسی توانایی حذف سلنیت در لاکتوباسیل های مقاوم جدا شده از پنیرهای سنتی مناطق بکر روستایی استان کردستان است.

روش بررسی: 25 نمونه پنیر محلی از مناطق بکر روستایی استان کردستان جمع آوری شد. غنی سازی در محیط های کشت MRS حاوی سلنیت انجام گرفت. الگوی تحمل پذیری سویه های جدا شده نسبت به سلنیت، به وسیله روش های رقیق سازی مایع و رقت در آگار بررسی شد. میزان سلنیت موجود در محیط های واکنش با روش کالری متریک ارزیابی گردید. از روش تک عاملی برای بهینه سازی حذف استفاده شد. شناسایی ملکولی با تکثیر ژن 16S rRNA و تعیین توالی انجام گرفت.

 یافته ها: از مجموع 30 سویه باکتری مقاوم جدا شده، Lactobacillus sp. Tra cheese 6 بالاترین مقاومت توام با احیای سلنیت به سلنیوم عنصری (125 میلی مولار) را نشان داد. بیشترین میزان حذف میکروبی سلنیت در غلظت بیومس 50 گرم در لیتر، غلظت کلرید سدیم 4 درصد، دمای 37 درجه سانتی گراد، pH  برابر 2/7، دور هم زن rpm 100 و میزان سلنیت 45 میلی مولار مشاهده شد. تحت شرایط بهینه شده، پس از 60 ساعت میزان یون سلنیت در سوپرناتانت از 45 میلی مولار به حدود 8/1 میلی مولار رسید که تقریبا 96 درصد حذف شد.

بحث و نتیجه گیری: با توجه به  یافته های به دست آمده در این مطالعه، جداسازی و تعیین خصوصیت لاکتوباسیلوس ها را می توان به عنوان کاتالیست های ایمن و اقتصادی و جایگزین مناسب روش های فیزیکوشیمیایی برای حذف فلزات و اکسی آنیون های سمی در صنعت آب و پساب پیشنهاد نمود.

واژه‏های کلیدی: سلنیت، اصلاح زیستی، لاکتوباسیلوس، بهینه سازی، الگوی تحمل پذیری.

 

J.Env. Sci. Tech., Vol 19, No.1, spring, 2017

 

 

 

 


Selenite-resistant Lactobacilli isolated from local cheeses made in the rural areas of Kurdistan and its application for the removal of selenite from water and wastewater

 

Morahem Ashengroph [3]*

m.ashengroph@uok.ac.ir

Davoud Saedi [4]

               

Abstract

Background and Objective: The presence of the high concentrations of selenite in the industrial wastewater that and subsequently entering water supply and the food chain are being health concerns. Thus, microbial bio-remediation has been considered as a safety tool for removing selenite. The aim of the current study was to evaluate the capability of selenite removal using Selenite-resistant Lactobacilli  isolated from local cheeses made in the rural areas of Kurdistan.

Method: 25 local sample were collected from pristine areas kordestan provinceEnrichment was performed in the MRS media containing selenite (SeO3-2). Selenite tolerance pattern among bacterial isolates was performed by using the agar dilution test and broth dilution method.

The selenite content in the reaction medium was measured by a colorimetric assay. The One-factor-at-a- time method (OFAT) was used for the process optimization. Molecular characterization was performed by amplification of 16S rDNA gene and sequencing.

Findings:A total of 30 selenite-resistant bacteria were isolated and one of the strain, namedLactobacillus sp. Tra cheese 6, show the highest resistance to selenite (125 mM) along with bio-reduction efficiency. The maximum selenite removal was observed at the following conditions: initial biomass concentration 50 g/l, NaCl 4% (w/v), Temperature 37 C, pH 7.2 and agitation 100 rpm in the presence selenite with initial concentration of 45 mM. Under the optimal conditions, the concentration of SeO3-2 ion in the reaction supernatant decreased by 96% (from 45 to 1.8 mM) after 60 hours of incubation.

Discussion and Conclusion: Regarding the results obtained in the current investigation, isolation and determined of Lactobacilli as safety and economic catalysts and to develop suitable alternative methods for the removal of heavy metal oxyanions from water and wastewater are suggested.

 

Keywords: Selenite, Bio-Remediation, Lactobacillus, Optimization, Tolerance Pattern.

 

 

مقدمه


سلنیوم یک عنصر شیمیایی با عدد اتمی 34 و دارای خواص غیر فلزی است که به طور طبیعی در پنج حالت اکسایش به صورت سلنیوم عنصری، سلنید، سلنیت، سلنات و سلنیوم ارگانیک وجود دارد که هر کدام خواص توکسیکی و شیمیایی بسیار متفاوتی دارند و در این میان سلنیت با توجه به حلالیت بالا در محیط هـای آبـی و تمایل زیـاد بــه تجمع زیستی، سمی ترین فرم اکسی آنیونی سلنیوم محسوب می شود (1). سلنیوم به علت عوامل طبیعی و انسانی در بخش های مختلفی از محیط زیست یافت می شود. این عنصر،  از یک سو سمی و  از سوی دیگر خواص سودمندی برای سلامتی دارد. سلنیوم در سطوح پایین، اهمیت فیزیولوژیک دارد و به عنوان ریز مغذی ضروری برای انسان ها و حیوانات محسوب می شود. سلنیوم برای سنتز و بیان سلنوپروتیین ها ضروری است. این عنصر دارای عملکرد آنتی اکسیدانی و تنظیم متابولیسم هورمونی تیرویید بوده و در تقویت سیستم ایمنی بدن نقش دارد و هم چنین بر رشد ویروس HIV تأثیر بازدارندگی داشته و نقش سودمندی در تولید مثل، پیشگیری از بیماری های قلبی و عروقی و اختلالات خلقی ایفا می کند (2 و 3). با این حال، سلنیوم در فرم محلول به‌‌‌ ویژه در فرم اکسی آنیون سلنیت دارای تجمع زیستی است، یعنی غلظت آن ممکن است در امتداد زنجیره ی غذایی افزایش یابد. وقتی سلنیوم محلول (سلنیت) به سطوح خاصی از غلظت می رسد، بسیار سمی و منجر به سلنوزیس می شود که از علایم آن می توان موی شکننده، ناخن هــای لایــه لایه شــده، کلفت و شــکننده را نام برد کــه در برخی موارد از دســت می روند. همــراه با این علایم، بوی ســیر در نفس و روی پوست مشاهده می‌‌ گردد. علایم دیگر مانند تهوع و ادم ریوی از ویژگی های ســمیت شــدیدتر حاد ســلنیوم می باشــد (4). هم چنین مواجهه مزمن با غلظت بالای سلنیت اثرات کارسینوژنی ( پروستات و کبد )، سیتوتوکسیکی ( توقف چرخه‌ ی سلول و بازدارنده ی رشد سلول ) و ژنوتوکسی ( تأثیر گذاری بر DNA) دارد (5). آلودگی زیست محیطی توسط سلنیوم ممکن است به علت عوامل طبیعی و انسانی باشد. منابع و عوامل طبیعی شامل هوازدگی سنگ ها و خاک های حاوی سلنیوم و فوران های آتشفشانی هستند. منابع انسانی شامل احتراق زغال سنگ، معدن کاری، کشاورزی، پالایش نفت، تولید آفت کش، تولید شیشه و فوتوسل ها هستند (6 و 7). محیط های آبی می توانند  توسط سلنیوم حاصل از پساب کشاورزی، پساب معدن، پسماندهای حاصل از نیروگاه های ترموالکتریکی با سوخت فسیلی، پالایشگاه های نفت و کان سنگ های فلز آلوده شوند (8). سطوح بالای سلنیوم در آب های سطحی، زیرزمینی و پساب ها می توانند مشکلات محیطی جدی را به دنبال داشته باشند. آژانس حفاظت از محیط زیست آمریکا (USEPA) 5 میکرو گرم بر لیتر از سلنیوم را به عنوان یک مقدار همیشگی برای حیات آبی ( برحسب برآورد بالاترین غلظت سلنیوم در آب سطحی که اجتماع آبزی برای مدتی بدون به بار آوردن یک تأثیر غیر قابل قبول در معرض آن قرار می گیرد ) اعلام کردند. این مقدار در سال 1999 تعیین شد و اخیراً به روز شده است (9). به منظور دستیابی به این استاندارد ها از آب آشامیدنی، اجرای روش حذف سلنیوم از آب های سطحی و زیرزمینی برای تولید آب آشامیدنی الزامی است. پساب های آلوده به سلنیوم نیز به منظور به حداقل رساندن تأثیری که بر منابع آب طبیعی دارند یا برای این که مجدداً قابل استفاده باشند، باید به طور مناسبی پالایش شوند. حذف سلنیوم از محلول های آبی می تواند به خاطر مقادیر بالای آن که همیشه در آب ها تولید می شوند و غلظت های پایین و نیز به خاطر انواع فرم های سلنیوم موجود در آب پیچیده و هزینه بر می باشد. بنابراین در حوزه ی صنعت توجه زیادی به این موضوع شده و فناوری های بسیاری در مقیاس آزمایشی و مقیاس تجاری جهت دستیابی به پیشرفت های مهم آزموده شده اند (10 و 11). شناسایی بهترین روش مقرون به صرفه مشکل است، چون نوسانات و تغییرات حاصل در ویژگی های آب و پساب به روش های خاصی با هزینه های مختلف بستگی دارد و اجرای تکنولوژیکی پایه ای موردی باید ارزیابی، بهینه سازی و اثبات شود (9 و 10). با وجود روش های متفاوت از جمله رسوب شیمیایی، اکسیداسیون و یا احیاء، فیلترینگ، تبادل یونی، اسمز معکوس، تکنولوژی غشایی، تبخیر و تیمار الکتروشیمیایی برای حذف فرم های سمی سلنیوم وجود دارند (12). با این وجود، روش های مذکور از نظر زیست محیطی مشکل ساز، گران قیمت و نیازمند تجهیزات خاص بوده و از همه مهم تر ناکارآمدی کاتالیست های شیمیایی در حذف یا کاهش غلظت های پایین سلنیت، استفاده اقتصادی از روش های فیزیکوشیمیایی را با چالش مواجه کرده است. شایان ذکر است در محیط های طبیعی، سویه های میکروبی مختلف متعلق به جنس باکتری ها، قارچ های رشته ای و مخمرها شناخته شده هستند که قادر به حذف و احیای سلنیت به فرم کمتر سمی سلنیوم می باشند. بنابراین استراتژی زیست پالایی میکروبی یعنی استفاده از توانمندی میکروارگانیسم ها  به عنوان کاتالیست های مبتنی بر شیمی سبز به صورت جایگزینی کارآمد و ارزان قیمت در جهت کاهش یا حدف غلظت های سمی سلنیت از محیط های آلوده معرفی شده است (13). اگرچه مطالعات وسیعی در ارتباط با نقش بالقوه ی باکتری های مولد اسید لاکتیک در بهبود کیفیت محصولات لبنی در سطح کشور صورت گرفته است، ولی توانمندی ذاتی باکتری های مذکور به عنوان کاتالیست های مبتنی بر شیمی سبز در فرآیندهای پالایش زیستی فلزات و اکسی آنیون های سمی از محیط های آلوده کمتر مورد توجه محققین داخلی قرار گرفته است. برای این منظور، در مطالعه اخیر توانایی حذف سلنیت در لاکتوباسیل های جدا شده از پنیرهای محلی مناطق روستایی کردستان مورد سنجش قرار گرفت. دستیابی به لاکتوباسیل های بومی با پتانسیل تحمل پذیری ذاتی بالا نسبت به یون سمی سلنیت، شناسایی بیوشیمیایی و ملکولی سویه های غربال گری شده و بررسی تاثیر پارامترهای مختلف نظیر غلظت اولیه سلنیت، غلظت بیومس سلول، غلظت نمک کلرید سدیم، اثرات دما، pH و دور شیکر و در نهایت زمان واکنش زیست تبدیلی بر راندمان حذف سلنیت با امکان به کارگیری کاتالیست های میکروبی مذکور به عنوان جایگزین احتمالی روش های فیزیکوشیمیایی در حذف غلظت های سمی سلنیت از منابع آبی و پساب های مرتبط، هدف از انجام مطالعه اخیر بوده است.

مواد و روش ها

مواد و محیط های کشت: اکسی آنیون سلنیت سدیم هفت آبه (Na2SeO3.7H2O) از شرکت سیگما آلدریچ، انگلستان تهیه گردید. معرف 3 و 3 دی آمینو بنزیدین هیدروکلراید (3,3- Diaminobenzidine hydrochloride) از شرکت مرک، آلمان خریداری شد. محیط کشت de ManRogosaSharpe (MRS) ]پپتون 10 گرم در لیتر، عصاره گوشت 8 گرم در لیتر، عصاره مخمر 4 گرم در لیتر، د- گلوکز 20 گرم در لیتر، استات سدیم 5 گرم در لیتر، تری آمونیوم سیترات 2 گرم در لیتر، سولفات منیزیم 2/0 گرم در لیتر، سولفات منگنز 05/0 گرم در لیتر، دی پتاسیم فسفات 2 گرم در لیتر، پلی سوربات 80 1 گرم در لیتر و pH برابر 2/6[ از کمپانی QUELAB تهیه گردید. محیط کشت لیتموس میلک (پودر شیر بی چربی 10 گرم در لیتر، معرف لیتموس 5/0 گرم در لیتر، سولفیت سدیم 5/0 گرم در لیتر) از شرکت QUELAB، آگارز، K2HPO4 و KH2PO4 از مرک و  آگار- آگار از شرکت کاردان آزما خریداری شد. مواد مصرفی جهت واکنش زنجیره ای پلیمراز (PCR) و هم چنین کیت استخراج DNAی مخصوص باکتری های گرم مثبت از شرکت سینا کلون تهیه گردید.

غنی سازی و جداسازی لاکتوباسیلوس های مقاوم به سلنیت: برای غنی سازی و جداسازی لاکتوباسیل های مقاوم به سلنیت، 25 نمونه پنیر سنتی از مناطق روستایی بکر شهرستان های استان کردستان در ظروف استریل جمع آوری شد. نمونه ها پس از انتقال به آزمایشگاه میکروبیولوژی در دمای 4 درجه سانتی گراد محافظت شدند. 10گرم از هر نمونه در 90 میلی لیتر سیترات سدیم استریل 2 درصد (وزنی/حجمی) انتقال داده شد. 1 درصد از سوسپانسیـون تهیــه شده در محیط های مایع MRS  غنی شده با 25 میلی مولار سلنیت تلقیح گردید. ارلن ها روی شیکر با دور rpm 150 و دمای 37 درجه سانتی گراد به مدت 72 ساعت گرماگذاری شدند. پس از 3 تا 5 بار پاساژ متوالی، کلنی ها بر روی محیط های کشت MRS آگار حاوی 25 میلی مولار سلنیت خالص سازی گردیدند. کلنی های خالص ایجاد شده از نظر ریخت شناسی، تست گرم، تست تحرک، کاتالاز و اکسیداز، تست احیای نیترات، هیدرولیز ژلاتین و تست اندول مورد بررسی قرار گرفته است (13). پس از تهیه تک کلنی های خالص، لاکتوباسیلوس های مقاوم به سلنیت جدا شده در لیتموس میلک نگه داری شدند. برای این منظور، باکتری ها در محیط کشت MRS کشت داده شدند. سپس باکتری ها را به محیط کشت لیتموس میلک در درون لوله های کوچک 5/1 میلی لیتری اپندروف وارد کرده، سه ساعت در حرارت 37 درجه سانتی گراد نگه داری شدند. پس از اینکه رنگ محیط کشت کمی به رنگ قرمز درآمد در فریزر جهت استفاده کشت های بعدی قرار داده شدند (14).

تعیین میزان مقاومت به سلنیت: برای بررسی الگوی تحمل پذیری لاکتوباسیل های مقاوم به سلنیت، از روش رقیق سازی مایع (Broth dilution method) استفاده شد (15). برای این منظور، حجم های یکسان از هر سوسپانسیون باکتریایی معادل نمی مک فارلند (106×5/1) به محیط های MRS براث حاوی غلظت های مختلف از یون سلنیت (30 تا 130 میلی مولار) تلقیح گردید. سپس در دمای 37 درجه سانتی گراد به مدت 24 ساعت و با دور شیکر rpm 150گرماگذاری شد. رشد میکروبی با اندازه گیری جذب در طول موج 600 نانومتر با استفاده از دستگاه اسپکتروفتومتر ارزیابی شد. حداقل غلظت مهار کنندگی رشد (MIC) به عنوان کمترین غلظت یون سلنیت که باعث ممانعت از رشد باکتری می شود، تعیین شد. از روش رقیق سازی در آگار (Agar dilution method) و براساس توصیه Wiegand  و همکاران (16) برای تایید نتایج تست رقیق سازی مایع استفاده گردید. به طور خلاصه، 20 میلی لیتر محیط های کشت MRS آگار با غلظت های مختلف ذکر شده از یون سلنیت مخلوط و به آن 10 میکرولیتر از سوسپانسیون باکتری های تهیه شده با غلظت معادل نیم مک فارلند تلقیح و پلیت های مذکور در دمای 37 درجه سانتی گراد به مدت 24 ساعت انکوبه گذاری شدند. همه آزمایشات سه بار تکرار شد.

تشخیص و تعیین هویت سویه باکتری Tra cheese6: شناسایی اولیه سویه کارآمد Tra cheese6 براساس مطالعات ریخت شناسی، فیزیولوژیک و تست های بیوشیمیایی صورت گرفت (17). تست هایی که برای شناسایی سویه مذکور استفاده شد عبارتند از: رنگ آمیزی گرم، کاتالاز، اکسیداز، احیای نیترات، ذوب ژلاتین، تست اندول، تست حرکت، رشد در دماهای 42 و 45 درجه سانتی‌ گراد، رشد در 5/6 درصد وزنی/حجمی NaCl، تولید NH3 از آرژنین و آزمایش تخمیر قندها از جمله گلوکز، گالاکتوز، سوکروز، مالتوز، مانیتول، تری هالوز، زایلوز و رافینوز (Garvie 1988). سویه باکتری مذکور با استفاده از روش های ملکولی و فیلوژنتیکی مورد شناسایی دقیق تر قرار گرفت. برای این منظور، ابتدا DNA ژنومی با استفاده از کیت استخراج DNA از باکتری های گرم مثبت طبق دستورالعمل شرکت سازنده انجام شد. واکنش زنجیره ای پلیمراز به کمک جفت پرایمرهای رفت Fd1 (AGAGTTTGATCCTGGCTCAG) و برگشت Rp2 (ACGGCTACCTTGTTACGACTT) ویژه ژن S rDNA 16 انجام شد (18). واکنش PCR در حجم نهایی 25 میکرولیتر صورت گرفت. غلظت مواد مصرفی در واکنش PCR شامل 5/12  میکرولیتر Master mix (حاوی بافر PCR، MgCl2، dNTPs و آنزیم Taq-polymerase)، یک میکرولیتر پرایمرهای رفت و برگشت (غلظت تقریبی 10 میکرومولار)، یک میکرولیتر DNA ی الگو (غلظت تقریبی 50 نانوگرم بر میکرولیتر) و 5/9 میکرولیتر آب PCR بود. شرایط واکنش PCR شامل دناتوراسیون اولیه 95 درجه سانتی گراد به مدت 1 دقیقه و سپس 30 سیکل شامل 95 درجه سانتی گراد به مدت 1 دقیقه، 50 درجه سانتی گراد به مدت 1 دقیقه و 72 درجه سانتی گراد به مدت 2 دقیقه برآورد شد. بسط نهایی در دمای 72 درجه سانتی گراد به مدت 10 دقیقه انجام گرفت. پس از انجام واکنش PCR، پنج میکرولیتر از محصول PCR به ژل آگارز 1 درصد انتقال داده شد و سپس به وسیله الکتروفورز و مشاهده باند 1500 جفت بازی صحت PCR و عدم وجود آلودگی تایید شد. محصول PCR تخلیص شده جهت تعیین توالی به شرکت ماکروژن کره جنوبی ارسال شد. با مشخص شدن توالی های دریافتی، این توالی ها با استفاده از الگوریتم BLASTN در سایت NCBI مورد بررسی قرار گرفت و براساس اطلاعات موجود در بانک ژنی، در نهایت درخت فیلوژنتیکی به کمک نرم افزار MEGA.6 بر پایه روش Neighbor-Joining و با بوت استرپ 1000 تکرار ترسیم شد (19).

حذف سلنیت توسط لاکتوباسیلوس سویه Tra cheese6 به عنوان بیوکاتالیزور و اثر عامل های مختلف بر روی حذف: در این بخش از پژوهش، حذف سلنیت به وسیله سلول های در حال استراحت Lactobacillus sp. Tra cheese 6 تحت شرایط مختلف محیطی و رشد مورد ارزیابی قرار گرفت. برای سنجش میزان سلنیت موجود در محیط های واکنش زیست تبدیلی از روش کالری متری (رنگ سنجی) به کمک معرف 3و3- دی آمینو بنزیدین با استفاده از دستگاه اسپکتروفتومتر استفاده شد (20). در این روش، تعیین کمی مقدار سلنیت اولیه و باقی مانده در محیط واکنش با استفاده از معرف 3و3- دی آمینو بنزیدین در غلظت نهایی 5/0 درصد وزنی/حجمی در اسید کلریدریک 5 مولار و تشکیل کمپلکس رنگی (زرد رنگ) و با استفاده از ترسیم منحنی استاندارد سلنیت (جذب بر حسب غلظت) در طول موج 420 نانومتر انجام شد. برای تهیه سلول های در حال استراحت لاکتوباسیلوس غربال گری شده، سویه مذکور به محیط کشت MRS مایع تلقیح و به مدت 24 ساعت در دمای 37 درجه سانتی گراد و با دور شیکر rpm 150 گرماگذاری گردید. سپس توده سلول باکتری با استفاده از سانتریفیوژ (rpm 4500 به مدت 10 دقیقه) برداشت و پس از شستشو بیومس سلول در بافر فسفات 100 میلی مولار (K2HPO4/KH2PO4)، از این سلول های برداشت شده به عنوان کاتالیست برای آزمایشات سلنیت زدایی استفاده گردید. جهت سنجش اثر غلظت های اولیه سلنیت، آزمایشات سلنیت زدایی در غلظت های مختلف (15، 30، 45 و 60 میلی مولار) بررسی گردید. سایر عوامل شامل غلظت اولیه بیومس سلولی 10 گرم در لیتر، دمای 37 درجه سانتی گراد، pH برابر 2/6، دور شیکر rpm 150 و زمان انکوباسیون 36 ساعت، ثابت در نظر گرفته شدند. هم چنین حذف سلنیت در غلظت های مختلف از بیومس سلول بر حسب وزن تر (10، 25، 50، 75 و 100 گرم در لیتر)، غلظت های مختلف کلرید سدیم (2، 4 و 5/6 درصد وزنی/حجمی)، pH های متفاوت (8/5، 4/6، 2/7 و 8/7)، دماهای مختلف (28، 32، 37 و 42 درجه سانتی گراد) در محیط واکنش حاوی 45 میلی مولار یون سلنیت و پس از 36 ساعت گرماگذاری تخمین زده شد. پس از تعیین سطح بهینه عوامل واکنش، اثر زمان واکنش زیست تبدیلی (24، 36، 48، 60 و 72 ساعت) بر حذف سلنیت توسط لاکتوباسیلوس جداسازی شده بررسی گردید. همه آزمایشات در ارلن های  250 میلی لیتری حاوی 50 میلی لیتر محیط بافری فسفات و به صورت سه تکرار انجام شد.  

تجزیه و تحلیل آماری : تحلیل آماری نتایج با استفاده از نرم افزار SPSS11.5، در دو سطح توصیفی و استنباطی صورت گرفت. در سطح توصیفی از شاخص های میانگین و انحراف معیار و در بخش آمار استنباطی از  آنالیز واریانس یک طرفه و براساس آزمون چند دامنه ای دانکن استفاده گردید. حداقل سطح معناداری در تمام آزمون فرضیه های مربوط (P<0.05) در نظر گرفته شد.

نتایج

جداسازی، تعیین الگوی مقاومت و شناسایی لاکتوباسیل های مقاوم به سلنیت: در مجموع 30 سویه باکتری مولد اسید لاکتیک مقاوم به سلنیت با پتانسیل تحمل پذیری ذاتی بالاتر از 25 میلی مولار نسبت به سلنیت از پنیرهای  محلی مناطق بکر روستایی استان کردستان جداسازی شد. از میان باکتری های غربال گری شده، 12 سویه براساس آزمون های فنوتیپی و تست های بیوشیمیایی به عنوان جنس لاکتوباسیلوس تشخیص داده شدند. باکتری های مذکور همگی میله ای گرم مثبت، کاتالاز منفی، اکسیداز منفی، بی حرکت، فاقد اسپور و قادر به ذوب ژلاتین و تولید اندول نبودند. باکتری های مذکور برای آزمون های بعدی برگزیده شدند. بررسی الگوی مقاومت به اکسی آنیون سمی سلنیت روی 12 سویه لاکتوباسیلوس مذکور انجام شد (نمودار 1).


 

نمودار 1- نتایج بررسی الگوی مقاومت نسبت به یون سمی سلنیت در سویه های لاکتوباسیلوس جدا سازی شده با استفاده از روش های رقیق سازی در مایع و رقت در آگار

Diagram 1. The results for the resistance pattern of isolated Lactobacilli strains to toxic selenite using agar and broth dilution methods

 

براساس نتایج بدست آمده، میزان MIC برای یون سلنیت در لاکتوباسیل های مقاوم بین حداقل 35 و حداکثر 125 میلی مولار تخمین زده شد. در این بین، بیشترین MIC در سویه Tra cheese 6 مشاهده شد که معادل 125 میلی مولار بود. سویه مذکور بعنوان سویه برتر مورد شناسایی فنوتیپی و فیلوژنتیکی قرار گرفت. شناسایی اولیه سویه مقاوم Tra6، با قابلیت احیای یون سلنیت به سلنیوم عنصری که با ایجاد کلنی قرمز رنگ در محیط کشت قابل تشخیص است (شکل 1) براساس ویژگی های ظاهری، فیزیولوژیکی و بیوشیمیایی انجام شد. براساس نتایج به دست آمده، ریخت شناسی کلنی به رنگ کرم متمایل به شیری، شفاف و لزج بود (شکل 1). رنگ آمیزی گرم نشان داد که سویه مذکور به شکل میله ای شکل، گرم مثبت و بدون اسپور است. نتایج آزمون های فیزیولوژیک و بیوشیمیایی براساس کتاب های مرجع نشان داد که سویه Tra cheese 6 متعلق به جنس لاکتوباسیلوس است. سویه مذکور از نظر آزمون های کاتالاز، اکسیداز، تولید آمونیاک از آرژنین، رشد در دمای 45 درجه سانتی گراد و تخمیر قند زایلوز منفی است. این در حالی است که سویه مذکور قابلیت رشد در 5/6 درصد نمک NaCl و دمای 42 درجه سانتی گراد را دارا بوده و هم چنین توانایی تخمیر قندهای گلوکز، سوکروز، مالتوز، مانیتول و ریبوز را دارد.

 

 

 

 

 

 

شکل 1- (A) کلنی خالص شده سویه Tra cheese 6 در محیط کشت MRS آگار پس از 24 ساعت انکوباسیون در دمای 37 درجه سانتی گراد و (B) کلنی خالص شده سویه Tra cheese 6 در محیط کشت MRS آگار حاوی 25 میلی مولار یون سلنیت پس از 24 ساعت انکوباسیون در دمای 37 درجه سانتی گراد

Figure 1. A: The purified colony of strain Tra cheese 6 was cultured on MRS agar medium at 37° C for 24 h (B) The purified colony of strain Tra cheese 6 was cultured on MRS agar medium supplemented with 25mM selenite at 37° C for 24 h (B)

 

 

شناسایی ملکولی سویه باکتری Tra cheese 6 با تکثیر قطعه 1500 نوکلئوتیدی ناحیه ژنی S rDNA16 با استفاده از پرایمرهای ویژه این ژن (Fd1 و Rp2) انجام شد (شکل 2).

 

 

شکل 2- باند S rDNA16 حاصل از واکنش PCR سویه باکتری Tra cheese 6 حاصل از ژل آگارز 1 درصد

Figure 2. 16S rDNA PCR gel electrophoresis of bacterial strain Tra cheese 6 on 1% agarose gel


 

 

توالی نوکلئوتیدی به دست آمده از تعیین توالی ژن S rDNA16 سویه مذکور در بانک ژنی NCBI بلاست شد. نتایج BLASTN نشان داد که سویه Tra cheese 6 دارای همولوژی 99 درصدی با Lactobacillus sp. (شماره دستیابی AY681129 در بانک ژنی) است. توالی ژن S rDNA16 باکتری جداسازی شده و 14 لاکتوباسیلوس مشابه ثبت شده در سایت NCBI به کمک نرم افزار Clustal X هم ردیف سازی گردید و درخت فیلوژنتیکی به کمک نرم افزار MEGA. 6 رسم شد (شکل 3). توالی نوکلئوتیدی ژن S rDNA16 باکتری کارآمد در بانک ژنی به شماره دستیابی ژنی KT033397 ثبت شد. براساس نتایج فنوتیپی و تایید نتایج با استفاده از آزمون های فیلوژنتیکی سویه لاکتوباسیل مقاوم به سلنیت غربال گری شده در پژوهش اخیر تحت نام Lactobacillus sp. strain Tra cheese 6 مورد شناسایی قرار گرفت. لاکتوباسیلوس بومی جداسازی شده به عنوان بیوکاتالیزورجهت آزمایشات سلنیت زدایی انتخاب شد.

 


 

 شکل 3- درخت فیلوژنتیکی سویه غربال گری شده Tra  cheese 6 به کمک نرم افزار MEGA.6 بر پایه روش Neighbor-Joining و با بوت استرپ 1000 تکرار (اعداد داخل پرانتز بیان گر شماره دستیابی در بانک ژن است)

Diagram 3- Phylogenetic tree of screened strain of Tra cheese 6 was constructed by MEGA6 software based on neighbor joining method with1000 bootstrapping (Genbank accession numbers are shown in parentheses)


 

 

نتایج ارزیابی توان حذف سلنیت توسط سلول های در حال استراحت Lactobacillus sp. strain Tra cheese 6 تحت شرایط محیطی و کشت مختلف: در این قسمت از مطالعه، تاثیر عوامل محیطی و رشد روی حذف میکروبی سلنیت توسط سلول های در حال استراحت لاکتوباسیلوس جداسازی شده سنجیده شد (نمودار 2). میزان حذف سلنیت در غلظت های مختلف سلنیت و بیومس سلول سنجش شد و بیشترین مقادیر حذف با راندمان های 3/21 و 9/38 درصد به ترتیب در غلظت های 45 میلی مولار سلنیت اولیه و 50 گرم در لیتر بیومس سلول مشاهده گردید (نمودار 2 قسمت های A و B). حذف سلنیت در حضور غلظت های مختلف نمک کلرید سدیم در محیط بافری حاوی 45 میلی مولار سلنیت و 50 گرم در لیتر بیومس سلول به عنوان کاتالیست مورد ارزیابی قرار گرفت (نمودار 2 قسمت C). بیشترین میزان حذف سلنیت (50 درصد) در حضور 4 درصد NaCl مشاهده گردید. میزان حذف سلنیت در دماهای 28 تا 42 درجه سانتی گراد و pH های 8/5 تا 8/7 در محیط واکنش حاوی 45 میلی مولار یون سلنیت، 50 گرم در لیتر بیومس سلول و 4 درصد کلرید سدیم سنجیده شد (نمودار 2 قسمت های D و E). بیشترین میزان حذف سلنیت در دمای 37 درجه سانتی گراد با راندمان 67 درصد و pH برابر 2/7 با راندمان 69 درصد مشاهده گردید. در نمودار (2) قسمت F، حذف سلنیت در حضور اثر دور شیکر های متفاوت در محیط بافری فسفات حاوی 45 میلی مولار سلنیت، 50 گرم در لیتر بیومس سلول، 4 درصد NaCl، pH برابر 2/7 و دمای 37 درجه سانتی گراد نشان داده شده است. همان طور که در شکل قابل مشاهده است، بیشترین میزان حذف سلنیت (7/72 درصد) در دور شیکر rpm 100 صورت گرفته که حکایت از بهینه فعالیت آنزیم موثر احتمالی در حذف سلنیت در مقدار مشخصی از اکسیژن دارد

 

 

نمودار 2-  اثر پارامترهای مختلف روی حذف سلنیت توسط سلول های در حال استراحت Lactobacillus sp. Tra cheese 6 در محیط بافری فسفات پس از 36 ساعت گرماگذاری

Diagram 2- Effect of different parameters on selenite removal by using resing cells of Lactobacillus sp. Tra cheese 6 in phosphatebuffer for 36 h incubation

 


پس از تعیین غلظت های بهینه عوامل موثر بر حذف سلنیت توسط سویه بومی Tra cheese 6 به کمک روش تک عاملی، مدت دوره حذف سلنیت تحت شرایط بهینه شده مورد ارزیابی قرار گرفت (شکل 4). براساس نتایج حاصل، ماکزیمم حذف سلنیت در ساعت 60 ام (حدود 96 درصد) مشاهده گردید.


 

شکل 4- اثرات زمان انکوباسیون بر روی حذف سلنیت در باکتری Lactobacillus sp. Tra cheese 6 در محیط بافری دارای 50 گرم در لیتر بیومس سلول، سلنیت با غلظت 45 میلی مولار، 4 درصد نمک کلرید سدیم، دمای 37 درجه سانتی گراد، pH برابر 2/7، دور هم زن 100 و در حضور 45 میلی مولار یون سلنیت

Figure 4- Time of course selenite removal actobacillus sp. Tra cheese 6 at the following conditions: initial biomass concentration 50 g/l, NaCl 4% (w/v), Temperature 37° C, pH 7.2 and agitation 100 rpm in the presence selenite with initial concentration of 45 mM.


در ادامه طیف های جذبی اسپکتروفتومتر حاصل از حذف سلنیت توسط سلول های در حال استراحت سویه بومی Tra cheese 6 در محیط واکنش بهینه شده از طریق روش تک عاملی بررسی شد. همان طور که در شکل 5 مشاهده می شود، سلول های در حال استراحت سویه مذکور از لحاظ متابولیکی فعال بوده و قابلیت حذف سلنیت را در محیط واکنش زیست تبدیلی دارا می باشد، از طرفی با توجه به تغییر رنگ محیط کشت به رنگ قرمز، مکانیسم حذف سلنیت در سویه مذکور به صورت احیای سلنیت به سلنیوم عنصری می باشد.


 

 

شکل 5- a0 و b0: طیف جذبی و رنگ محیط واکنش زیست تبدیلی در ساعت صفر واکنش، a60 و b60: طیف جذبی و رنگ محیط واکنش زیست تبدیلی در ساعت 60 پس از تلقیح سلول های در حال استراحت Lactobacillus sp. Tra cheese 6 در محیط های زیست تبدیلی بهینه شده توسط روش تک عاملی به کار گرفته شده

Figure 5- a0 and b0: Absorption spectrum and color bioconversion reaction at zero time, a60 and b60: Absorption spectrum and color bioconversion reaction after 60h incubation time under resting cells of Lactobacillus sp. Tra cheese 6 in bioconversion media which has been optimized by one-factor-at-a-time method


 


بحث


اکسی آنیـون هـای سلنیوم شـامـل سلنیت و سلنـات در غلظت های مختلف در آب های سطحی، آب های زیرزمینی و پساب بسیاری از صنایع نظیر معدن کاری زغال سنگ، صنعت نفت، صنایع کشاورزی و نیروگاه های ترموالکتریکی وارد محیط زیست می گردند. این ترکیبات هم چنین در طی تولید آفت کش های سنتزی، تولید شیشه های رنگی و سل های نوری نیز تولید می شوند (7). در این میان، سلنیت به سبب سمیت بسیار بالا و تمایل به تجمع زیستی حتی در غلظت های بسیار پایین به عنوان آلاینده ی دارای اولـویت زیست محیطی شنـاختـه می شود. روش های شیمیایی از جمله فرآیند ترسیب، احیا، تبادل یونی و تبخیر الکتروشیمیایی و روش های فیزیکی بالاخص فرآیند اسمز معکوس برای تصفیه منابع آب و فاضلاب های صنعتی آلوده به سلنیت پیشنهاد شده اند (12). مشکلاتی نظیر صرف هزینه های اقتصادی بالا، تولید محصولات جانبی سمی و راندمان پایین کاتالیست های شیمیایی، عوامل محدود کننده برای تجاری سازی روش های فیزیکوشیمیایی مذکور هستند. بنابراین پالایش زیستی با استفاده از میکروارگانیسم ها به عنوان کاتالیست های سبز، روشی مناسب و کارآمد برای کاهش یا حذف سلنیت سمی از منابع آب و پساب می باشد (21). طبق اصول شیمی سبز، غربال گری بیوکاتالیست های میکروبی جدید برای به حداقل رساندن یا حذف انتشار اکسی آنیون های سمی سلنیوم باید در اولویت قرار بگیرد و سپس کارآیی فرآیند سلنیت زدایی مورد ارزیابی قرار گیرد. در این مطالعه، در راستای توسعه یک روش زیستی هم سو با محیط زیست، توانمندی سلول های در حال استراحت لاکتوباسیل های بومی به عنوان بیوکاتالیست های امن و کارآمد برای آزمایشات حذف میکروبی سلنیت، برای نخستین بار در سطح کشور، مورد بررسی قرار گرفت. لاکتوباسیل ها، باکتری های میله ای گرم مثبت، فاقد اسپور، اکسیداز و کاتالاز منفی بوده و قادر به احیای نیترات نمی باشند. تاکنون نزدیک به 56 گونه از این باکتری ها تعیین خصوصیت شده اند (22). لاکتوباسیل ها با توجه به پوشش دادن استانداردهای GRAS برای سلامتی و تندرستی از اهمیت بالایی برخوردار هستند. از این باکتری ها ممکن است به عنوان کاتالیست جهت پالایش فلزات و اکسی آنیون های سمی استفاده گردد (23). برای این منظور، 12 سویه باکتری متعلق به جنس لاکتوباسیلوس مقاوم به اکسی آنیون سمی سلنیت از پنیرهای جمع آوری شده از روستاهای استان کردستان جداسازی شد. مقاومت ذاتی سویه های غربال گری شده نسبت به سلنیت ارزیابی شد. بالاترین میزان مقاومت (125 میلی مولار) همراه با احیای سلنیت به سلنیوم در سویه Tra cheese 6 مشاهده شد. براساس تست های فنوتیپی و ملکولی انجام شده مشخص گردید که سویه مذکور متعلق به جنس لاکتوباسیلوس بوده و تحت نام Lactobacillus sp. Tra cheese 6 تعیین هویت و با شماره دسترسی KT033397 در بانک ژنی NCBI ثبت شد. میزان مقاومت به سلنیت در لاکتوباسیل بومی جدا شده در مقایسه با بسیاری از سویه های میکروبی متعلق به جنس های Rhodobacter، Ralstonia، Rhodospirillum، Rhizobium، Aeromonas، Azospira، Stenotrophomonas، Enterococcus، Escherichia، Bacillus و Comamonasبسیار بالاتر گزارش شد. در سویه های مذکور حداقل مقاومت 2 میلی مولار و حداکثر 100 میلی مولار  بود (13 و 24). با این حال، مقاومت های 150 میلی مولاری نیز در برخی سوش های متعلق به جنس Pseudomonas گزارش شده است (13). در ادامه این پژوهش به کمک روش کالری متری و با کمک معرف 3و3- دی آمینو بنزیدین میزان کاهش و حذف یون سمی سلنیت در محیط واکنش زیست تبدیلی سویه بومی Tra cheese 6 و تحت تاثیر عوامل موثر بر فرآیند حذف مورد ارزیابی قرار گرفت. بیشترین میزان حذف سلنیت تحت شرایط سلول های در حال استراحت لاکتوباسیلوس بومی جدا شده در شرایط زیر مشاهده گردید: غلظت اولیه بیومس سلول 50 گرم در لیتر، غلظت نمک کلرید سدیم 4 درصد وزنی/حجمی، دمای واکنش 37 درجه سانتی گراد، pH واکنش 2/7، دور هم زن rpm 100 و میزان غلظت یون سلنیت در محیط واکنش زیست تبدیلی 45 میلی مولار بود. تحت شرایط بهینه شده بالا پس از 60 ساعت میزان غلظت یون سلنیت در سوپرناتانت از 45 میلی مولار به حدود 8/1 میلی مولار رسید که تقریبا 96 درصد یون سلنیت حذف شد. در مطالعه Di Gregorio و همکاران (25)، یک سویه باکتری مقاوم به سلنیت تحت نام Stenotrophomonas sp. strain SeITE02 معرفی گردید که این سویه قادر به حذف کامل یون سلنیت در غلظت 5/0 میلی مولاری پس از 52 ساعت واکنش بود. سویه SeITE02 در غلظت 2 میلی مولاری قادر به حذف 87 درصدی از یون سمی سلنیت پس از 120 ساعت انکوباسیون بود. در گزارشی که توسط Ikram و Faisal ارایه گردید، چندین گونه از جنس باسیلوس دارای مقاومت به سلنیت سدیم تا حداکثر 20 گرم در لیتر گزارش شد. در این بین بالاترین میزان حذف و احیا توسط گونه باکتری Bacillus pumilus به میزان 97 درصد با غلظت اولیه 5/0 گرم در لیتر، پس از 144 ساعت انکوباسیون گزارش گردید (26). هم چنین در مطالعه صورت گرفته توسط Mishra و همکاران مشخص شد که باکتری مقاوم به سلنیت جداسازی شده Bacillus megaterium قادر به حذف کامل یون سلنیت در غلظت اولیه 25/0 میلی مولار پس از 40 ساعت واکنش زیست تبدیلی است (27). در مطالعه مشابه ای که بر روی جنس متفاوتی از باکتری های مولد اسید لاکتیک توسط Pieniz انجام گرفت، حذف 80 درصدی از یون سلنیت توسط سویه باکتری LAB 18)  ) Enterococcus faecium در مدت 24 ساعت گزارش شد. در این بررسی حذف بهینه سلنیت در غلظت اولیه یون سلنیت به میزان 8 میلی گرم در لیتر، دمای 25 درجه سانتی گراد و pH برابر 7 مشاهده گردید (21).

 

نتیجه گیری کلی

با مقایسه نتایج این پژوهش با مطالعات مشابه صورت گـرفته می توان دستاوردهای زیر را نتیجه گرفت: Lactobacillus sp.  غربال گری شده در این پژوهش دارای ویژگی های ممتازی مانند پروبیوتیک بودن، فعالیت و پایداری در شرایط ملایم از نظر دما، pH و دور شیکر، فعالیت متابولیکی در شوری نسبتا بالا (تا 5/6 درصد)، مقاومت بالا نسبت به سلنیت و توانمندی مناسب در حذف توام با احیای سلنیت به سلنیوم عنصری است. با توجه به این ویژگی ها، جداسازی و تعیین هویت لاکتوباسیل های بومی مقاوم به فلزات سنگین و اکسی آنیون های سمی به عنوان کاتالیست های امن و اقتصادی جهت حذف آلاینده های محیطی از منابع آب و پساب پیشنهاد می شود. هم چنین امکان استفاده از این کاتالیست ها جهت حذف سلنیت سمی از پساب ها و آب های آلوده با درصد شوری نسبتاً بالا نیز وجود دارد.

 

منابع

  1. Fernádez-Martínez, A., Charlet, L., 2009. Selenium environmental cycling and bioavailability: a structural chemist point of view. Reviews in Environmental Science and Biotechnology, Vol. 8, No. 1, pp. 81–110.
  2. Rayman, MP., 2000. The importance of selenium to human health. Lancet, Vol. 356, No. 9225, pp. 233–241.
  3. Taylor, JB., Reynolds, LP., Redmer, DA., Caton, JS., 2009. Maternal and fetal tissue selenium loads in nulliparous ewes fed supranutritional and excessive selenium during mid- to late pregnancy. Journal of Animal Science, Vol. 87, No. 5, pp. 1828–1834.
  4. MacFarquhar, JK., Broussard, DL., Melstrom, P., 2010. Acute selenium toxicity ssociated with a dietary supplement. Archives of Internal Medicine, Vol. 170, No. 3, pp. 256–261.
  5. Zhang, H., Feng, XB., Chan, HM., Larssen, T., 2014. New insights into traditional health risk assessments of mercury exposure: implications of selenium. Environmental Science and Technology, Vol. 48, No. 2, pp, 1206–1212.

6.      Fernádez-Martínez, A., Charlet, L., 2009. Selenium environmental cycling and bioavailability: a structural chemist point of view. Reviews in Environmental Science and Biotechnology, Vol. 8, No. 1, pp. 81–110.

  1. Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K., Stackebrandt E, Editors. 2006. The Prokaryotes. 3rd ed.  NewYork. Springer.
  2. Navarro-Alarcon, M., Cabrera-Vique, C., 2008. Selenium in food and the human body: A review. Science of the Total Environment, Vol. 400, No. (1-3), pp. 115–141.
  3. USEPA., 2014. External Peer Review Draft — Aquatic Life Ambient Water Quality Criterion for Selenium — Freshwater 2014, EPA-820-F-14-005 2014. United states Environmental Protection Agency, Washington, DC.
  4. CH2MHILL., 2010. Review of available technologies for the removal of selenium from water - final report. Prepared for North American Metals Council.
  5. Sonstegard, J., Harwood, J., Pickett, T., 2007. Full scale implementation of GE ABMet biological technology for the removal of selenium from FGD wastewaters. Proceedings of the 68th International Water Conference vol. 2, p. 580 (Orlando, Florida, USA).
  6. Geoffroy N., Demopoulos GP., 2011. The elimination of selenium (IV) from aqueous solution by precipitation with sodium sulfide. Journal of Hazardous Materials, Vol. 185, No. 1, pp. 148–54.
  7. Zheng, S., Su, J., Wang, L., Yao, R., Wang, D., Deng, Y., Wang, R., Wang, G., Rensing, C., 2014. Selenite reduction by the obligate aerobic bacterium Comamonas testosteroni S44 isolated from a metal-contaminated soil. BMC Microbiology, Vol. 14, No. 1, pp. 204.
  8. Axelsson, L., 1998. Lactic acid Bacteria: Classification and Physiology. in LacticacidBacteria, Microbiology and Functional Aspects, edited by S. Salminen and A. Von Wright (Marcel Dekker Inc,New York), pp.1-73.
  9. Wikler, MA., Cockerill, FR., Craig, WA., Dudley, MN., Hecht, DW., 2006. Method for dilution antimicrobial test for bacteria that grow aerobically; approved standard. Clinical and Laboratory Standards Institute, Vol. 26, No. 2, pp. 9-16.
  10. Wiegand, I., Hilpert, K., Hancock, REW. , 2008. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nature Protocols, Vol. 3, No. 2, 163-175.
  11. Garvie, EI., 1984 .Taxonomy and Identification of Bacteria Important in Cheese and Fermented Dairy Products., in Advances in The Microbiology and Biochemistry of Cheese and Fermented Milk, edited by F. L. Davies and B. A. Law (Elsevier Applied Science Publishers LTD., England) , pp.35-67.
  12. Weisburg, WG., Barns, SM., Pelletier, DA., Lane, DJ.,1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology, Vol. 173, No. 2, pp. 697–703.
  13. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution, Vol. 30, No. 12, pp. 2725-2729.
  14. Hurlbut, JA., Burkepile, RG., Geisler, CA., Kijak, PJ., Rummel, NG., 1997.  Colorimetric determination of selenium in mineral premixes. Jouranl of AOAC International, Vol. 80, No. 4, pp. 709-16.
  15. Pieniz, S., Okeke, BC., Andreazza, R., Brandelli, A., 2011. Evaluation of selenite bio-removal from liquid culture by Enterococcus species. Microbiological research, Vol. 166, No. 3, pp. 176-185.
  16. de Roos, NM., Katan, MB., 2000.  Effects of probiotic bacteria on diarrhea, lipid metabolism, and carcinogenesis: a review of papers published between 1988 and 1998. American Journal of Clinical Nutrition, Vol. 71, No. 2, pp.  405-11.
  17. Halttunen, T., 2007. Removal of cadmium, lead and arsenic from water by lactic acid bacteria. InternationalJournalofFoodMicrobiology, Vol. 114, No. 1, pp. 30-35.
  18. Hunter, WJ., Manter, DK., 2008. Bio-reduction of selenite to elemental red selenium by Tetrathiobacter kashmirensis. Current microbiology, Vol. 57, No. 1, pp. 83-88.
  19. Di Gregorio, S., Lampis, S., Vallini, G., 2005. Selenite precipitation by a rhizospheric strain of Stenotrophomonas sp. isolated from the root system of Astragalus bisulcatus: a biotechnological perspective. Environment international, Vol. 31, No. 2, pp. 233-241.
  20. Ikram, M., Faisal, M., 2010. Comparative assessment of selenite (SeIV) detoxification to elemental selenium (Se0) by Bacillus sp. Biotechnology letters, Vol. 32, No. 9, pp. 1255-1259.
  21. Mishra, RR., Prajapati, S., Das, J., Dangar, TK., Das, N., Thatoi, H., 2011. Reduction of selenite to red elemental selenium by moderately halotolerant Bacillus megaterium strains isolated from Bhitarkanika mangrove soil and characterization of reduced product. Chemosphere, Vol. 84, No. 9, pp. 1231-1237.

 

 

 

 

 

 

 

 

 

 


 

 

 

 

 



1- استادیار میکروبیولوژی، عضو هیات علمی دانشگاه کردستان، دانشکده علوم، گروه علوم زیستی، سنندج، ایران * (مسوول مکاتبات).

2- دانشجوی کارشناسی ارشد زیست شناسی سلولی- مولکولی، دانشگاه کردستان، دانشکده علوم، گروه علوم زیستی، سنندج.

1- Assistant Professor of Microbiology, Department of Biological Sciences, Faculty of Sciences, University of Kurdistan, P.O. Box 416, Sanandaj, Iran.*(Corresponding Author)

2- MSc. Student of Molecular Cell Biology, Department of Biological Sciences, Faculty of Sciences, University of Kurdistan, Sananadaj, Iran.

  1. Fernádez-Martínez, A., Charlet, L., 2009. Selenium environmental cycling and bioavailability: a structural chemist point of view. Reviews in Environmental Science and Biotechnology, Vol. 8, No. 1, pp. 81–110.
  2. Rayman, MP., 2000. The importance of selenium to human health. Lancet, Vol. 356, No. 9225, pp. 233–241.
  3. Taylor, JB., Reynolds, LP., Redmer, DA., Caton, JS., 2009. Maternal and fetal tissue selenium loads in nulliparous ewes fed supranutritional and excessive selenium during mid- to late pregnancy. Journal of Animal Science, Vol. 87, No. 5, pp. 1828–1834.
  4. MacFarquhar, JK., Broussard, DL., Melstrom, P., 2010. Acute selenium toxicity ssociated with a dietary supplement. Archives of Internal Medicine, Vol. 170, No. 3, pp. 256–261.
  5. Zhang, H., Feng, XB., Chan, HM., Larssen, T., 2014. New insights into traditional health risk assessments of mercury exposure: implications of selenium. Environmental Science and Technology, Vol. 48, No. 2, pp, 1206–1212.

6.      Fernádez-Martínez, A., Charlet, L., 2009. Selenium environmental cycling and bioavailability: a structural chemist point of view. Reviews in Environmental Science and Biotechnology, Vol. 8, No. 1, pp. 81–110.

  1. Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K., Stackebrandt E, Editors. 2006. The Prokaryotes. 3rd ed.  NewYork. Springer.
  2. Navarro-Alarcon, M., Cabrera-Vique, C., 2008. Selenium in food and the human body: A review. Science of the Total Environment, Vol. 400, No. (1-3), pp. 115–141.
  3. USEPA., 2014. External Peer Review Draft — Aquatic Life Ambient Water Quality Criterion for Selenium — Freshwater 2014, EPA-820-F-14-005 2014. United states Environmental Protection Agency, Washington, DC.
  4. CH2MHILL., 2010. Review of available technologies for the removal of selenium from water - final report. Prepared for North American Metals Council.
  5. Sonstegard, J., Harwood, J., Pickett, T., 2007. Full scale implementation of GE ABMet biological technology for the removal of selenium from FGD wastewaters. Proceedings of the 68th International Water Conference vol. 2, p. 580 (Orlando, Florida, USA).
  6. Geoffroy N., Demopoulos GP., 2011. The elimination of selenium (IV) from aqueous solution by precipitation with sodium sulfide. Journal of Hazardous Materials, Vol. 185, No. 1, pp. 148–54.
  7. Zheng, S., Su, J., Wang, L., Yao, R., Wang, D., Deng, Y., Wang, R., Wang, G., Rensing, C., 2014. Selenite reduction by the obligate aerobic bacterium Comamonas testosteroni S44 isolated from a metal-contaminated soil. BMC Microbiology, Vol. 14, No. 1, pp. 204.
  8. Axelsson, L., 1998. Lactic acid Bacteria: Classification and Physiology. in LacticacidBacteria, Microbiology and Functional Aspects, edited by S. Salminen and A. Von Wright (Marcel Dekker Inc,New York), pp.1-73.
  9. Wikler, MA., Cockerill, FR., Craig, WA., Dudley, MN., Hecht, DW., 2006. Method for dilution antimicrobial test for bacteria that grow aerobically; approved standard. Clinical and Laboratory Standards Institute, Vol. 26, No. 2, pp. 9-16.
  10. Wiegand, I., Hilpert, K., Hancock, REW. , 2008. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nature Protocols, Vol. 3, No. 2, 163-175.
  11. Garvie, EI., 1984 .Taxonomy and Identification of Bacteria Important in Cheese and Fermented Dairy Products., in Advances in The Microbiology and Biochemistry of Cheese and Fermented Milk, edited by F. L. Davies and B. A. Law (Elsevier Applied Science Publishers LTD., England) , pp.35-67.
  12. Weisburg, WG., Barns, SM., Pelletier, DA., Lane, DJ.,1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology, Vol. 173, No. 2, pp. 697–703.
  13. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution, Vol. 30, No. 12, pp. 2725-2729.
  14. Hurlbut, JA., Burkepile, RG., Geisler, CA., Kijak, PJ., Rummel, NG., 1997.  Colorimetric determination of selenium in mineral premixes. Jouranl of AOAC International, Vol. 80, No. 4, pp. 709-16.
  15. Pieniz, S., Okeke, BC., Andreazza, R., Brandelli, A., 2011. Evaluation of selenite bio-removal from liquid culture by Enterococcus species. Microbiological research, Vol. 166, No. 3, pp. 176-185.
  16. de Roos, NM., Katan, MB., 2000.  Effects of probiotic bacteria on diarrhea, lipid metabolism, and carcinogenesis: a review of papers published between 1988 and 1998. American Journal of Clinical Nutrition, Vol. 71, No. 2, pp.  405-11.
  17. Halttunen, T., 2007. Removal of cadmium, lead and arsenic from water by lactic acid bacteria. InternationalJournalofFoodMicrobiology, Vol. 114, No. 1, pp. 30-35.
  18. Hunter, WJ., Manter, DK., 2008. Bio-reduction of selenite to elemental red selenium by Tetrathiobacter kashmirensis. Current microbiology, Vol. 57, No. 1, pp. 83-88.
  19. Di Gregorio, S., Lampis, S., Vallini, G., 2005. Selenite precipitation by a rhizospheric strain of Stenotrophomonas sp. isolated from the root system of Astragalus bisulcatus: a biotechnological perspective. Environment international, Vol. 31, No. 2, pp. 233-241.
  20. Ikram, M., Faisal, M., 2010. Comparative assessment of selenite (SeIV) detoxification to elemental selenium (Se0) by Bacillus sp. Biotechnology letters, Vol. 32, No. 9, pp. 1255-1259.
  21. Mishra, RR., Prajapati, S., Das, J., Dangar, TK., Das, N., Thatoi, H., 2011. Reduction of selenite to red elemental selenium by moderately halotolerant Bacillus megaterium strains isolated from Bhitarkanika mangrove soil and characterization of reduced product. Chemosphere, Vol. 84, No. 9, pp. 1231-1237.