جداسازی و شناسایی مولکولی باکتری‌های تجزیه‌کننده ی تیوسیانات از رسوبات دریاچه مهارلو استان فارس

نوع مقاله: مقاله پژوهشی

نویسندگان

1 کارشناس ارشد، گروه میکروبیولوژی، واحد جهرم، دانشگاه آزاد اسلامی، جهرم، ایران.

2 استاد، گروه میکروبیولوژی، واحد جهرم، دانشگاه آزاد اسلامی، جهرم، ایران*(مسوول مکاتبات)

10.22034/jest.2019.29647.3821

چکیده

زمینه و هدف:تیوسیانات ترکیبی یک کربنه معدنی وعضو مهمی از خانواده سیانید می‌باشد. تیوسیاناتاز منابع طبیعی و صنعتی مشتق شده ودر حجم وسیعی توسط صنایع استخراج فلزات و کک تولید می­شود. این ترکیب سمی باعث بروز اثرات نامطلوبی در موجودات زنده می­شود. با توجه به وجود این ترکیب سمی در دریاچه مهارلو، این پژوهش باهدف جداسازی و شناسایی باکتری­­های تجزیه کننده تیوسیانات از رسوبات دریاچه مهارلو صورت گرفت.
روش بررسی:نمونه برداری از پنج ایستگاه و طی دو فصل، در تابستان 94 و بهار 95 انجام گردید. جداسازی باکتری­های تجزیه کننده تیوسیانات در محیط M9 انجام شد.پس از شناسایی فیزیولوژی و بیوشیمیایی باکتری­های تجزیه کننده تیوسیانات، از تست­های حداقل غلظت بازدارندگی،سینتیک رشد و میزان تجزیه تیوسیانات توسط باکتری­های مقاوم استفادهشد. درپایان، باکتری­های مقاوم با روش PCRبراساس ژن S rRNA16، شناسایی شدند.
یافته­ها: نتایج نشان داد که 9 گونه باکتریایی توانایی تجزیه تیوسیانات در دریاچه مهارلو را داشتند. در این میان دو گونه باکتریایی Bacillus sphaericus و Micrococcus luteus دارای بالاترین پتانسیل درحذف و تجزیه تیوسیانات بوده و بالاترین مقاومت (50 گرم در لیتر) را نسبت به سایر باکتری‌ها نشان دادند. بیش­ترین قدرت تجزیه کنندگی تیوسیانات، مربوط به B. sphaericus(66/66 درصد) وM. luteus (50 درصد) بود که به ترتیب با ارزش شباهت 97 و 92 درصد با سویه­هایPlanococcus citreus strain NBRC 15849وBacillus aerius strain 24K شباهت داشتند.
بحث و نتیجه­گیری: یافته های تحقیق حاضر نشان داد که دریاچه مهارلو دارای باکتری های قدرت­مند در تجزیه تیوسیانات بوده به طوری که B. sphaericus تا 66/66 درصد قادر به تجزیه این ترکیب می باشد. با فراهم نمودن بستر مناسب جهت رشد این باکتری­ها می­توان از آن­ها جهت سمیت زدایی و حذف تیوسیانات از آب­های آلوده استفاده کرد

کلیدواژه‌ها

موضوعات


 

 

 

 

 

علوم و تکنولوژی محیط زیست، دورهبیست و یکم، شماره پنج ، مردادماه 98

                                        

 

جداسازی و شناسایی مولکولی باکتری­های تجزیه­کننده ی تیوسیانات از رسوبات دریاچه مهارلو استان فارس

 

فهیمه مطلبی [1]

فرشید کفیل زاده [2] *

f.kafilzadeh@gmail.com

تاریخ دریافت:25/5/96

تاریخ پذیرش:19/7/96

 

چکیده

زمینه و هدف:تیوسیانات ترکیبی یک کربنه معدنی وعضو مهمی از خانواده سیانید می‌باشد. تیوسیاناتاز منابع طبیعی و صنعتی مشتق شده ودر حجم وسیعی توسط صنایع استخراج فلزات و کک تولید می­شود. این ترکیب سمی باعث بروز اثرات نامطلوبی در موجودات زنده می­شود. با توجه به وجود این ترکیب سمی در دریاچه مهارلو، این پژوهش باهدف جداسازی و شناسایی باکتری­­های تجزیه کننده تیوسیانات از رسوبات دریاچه مهارلو صورت گرفت.

روش بررسی:نمونه برداری از پنج ایستگاه و طی دو فصل، در تابستان 94 و بهار 95 انجام گردید. جداسازی باکتری­های تجزیه کننده تیوسیانات در محیط M9 انجام شد.پس از شناسایی فیزیولوژی و بیوشیمیایی باکتری­های تجزیه کننده تیوسیانات، از تست­های حداقل غلظت بازدارندگی،سینتیک رشد و میزان تجزیه تیوسیانات توسط باکتری­های مقاوم استفادهشد. درپایان، باکتری­های مقاوم با روش PCRبراساس ژن S rRNA16، شناسایی شدند.

یافته­ها: نتایج نشان داد که 9 گونه باکتریایی توانایی تجزیه تیوسیانات در دریاچه مهارلو را داشتند. در این میان دو گونه باکتریایی Bacillus sphaericus و Micrococcus luteus دارای بالاترین پتانسیل درحذف و تجزیه تیوسیانات بوده و بالاترین مقاومت (50 گرم در لیتر) را نسبت به سایر باکتری‌ها نشان دادند. بیش­ترین قدرت تجزیه کنندگی تیوسیانات، مربوط به B. sphaericus(66/66 درصد) وM. luteus (50 درصد) بود که به ترتیب با ارزش شباهت 97 و 92 درصد با سویه­هایPlanococcus citreus strain NBRC 15849وBacillus aerius strain 24K شباهت داشتند.

بحث و نتیجه­گیری: یافته های تحقیق حاضر نشان داد که دریاچه مهارلو دارای باکتری های قدرت­مند در تجزیه تیوسیانات بوده به طوری که B. sphaericus تا 66/66 درصد قادر به تجزیه این ترکیب می باشد. با فراهم نمودن بستر مناسب جهت رشد این باکتری­ها می­توان از آن­ها جهت سمیت زدایی و حذف تیوسیانات از آب­های آلوده استفاده کرد.

واژه های کلیدی : تیوسیانات، PCR، باسیلوس اسفریکوس، میکروکوکوس لوتئوس، مهارلو.

 

J. Env. Sci. Tech., Vol 21, No.5,July, 2019

 

 

 

 

 


Isolation and molecular identification of thiocyanate biodegrationbacteria in the sediments from Maharloo lake, Fars province

 

Fahimeh Motallebi  [3]

Farshid Kafilzadeh  [4]*

f.kafilzadeh@gmail.com

 

Admission Date: October 11, 2017

Date Received: August 16, 2017

 

Abstract

Background and Objective: Thiocyanate is an inorganic, one compound carbon and an important member of the cyanide family, which is derived from natural and industrial sources. It is largely produced by Metal and coke extraction industries. This toxic compound, causing undesirable effects in living organisms. Due to the presence of this toxic compound in the Maharloo Lake, this study was aimed to isolate and molecular identification of bacteria degrading thiocyanate from sediments of the Maharloo.

Method: Sampling was performed during summer and spring of 2015 and 2016 form 5 stations. Isolation of Thiocyanate-degrading bacteria was conducted in the M9 medium. After identifying the physiological and biochemical thiocyanate degrading bacteria, MIC test, kinetics of growth and the rate of decomposition of thiocyanate were conducted. Finally, resistant bacteria were identified by PCR-based gene 16S rRNA.

Findings: 9 species had the ability of thiocyanate degradation in Maharloo lake. Bacillus sphaericus and Micrococcus luteus showed the highest potential to remove thiocyanate and the highest resistance (50 grams per liter) than other bacteria. The Most thiocyanate biodegrationrate was related to B. sphaericus (66.66%) and M. luteus (50%) which showed 97% and 92% homology to Planococcus citreus strain NBRC 15849and Bacillus aerius strain 24K respectively.

Discussion and Conclusion: The result of this study showed that the Maharloo lake contains powerful bacteria in thiocyanate biodegradation, so that B. sphaericus can break up to 66.66%. By providing a framework for the growth of these bacteria, they can be used to detoxify and remove thiocyanate from contaminated water.

                         

Keywords: thiocyanate, PCR, Bacillus sphaericus, Micrococcusluteus, Maharloo.

 

 

 

مقدمه


تیوسیانات (SCN) ترکیبی یک کربنه معدنی سولفیدی (1) پایدار، غیرقابل هیدرولیز و غیر فرار و مقاوم در شرایط اسیدی است(2). این ترکیب شیمیایی خطرناک، عضو مهمی از خانواده سیانید (CN) می‌باشد.سیانید با اتصال محکم به سیتوکرمc  اکسیداز که جزیی از سیستم انتقال الکترون است، از انتقال الکترون در زنجیره تنفسی جلوگیری می­کند(3). تیوسیانات همچنین به ‌طور ذاتی در فرایند سم‌زدایی زیستی سیانید تولید شده و در فاضلاب کک و معادن فلزی نیز یافت می‌شود (4).

این ترکیب در فرآیندهای گوناگون صنعتی از قبیل عکاسی (ظهور عکس)، رنگ­رزی، آبکاری طلا، تولید آفت‌کش، پلاستیک و فولاد، استخراج فلزات و کک استفاده می‌شود. از تیوسیانات همچنین برای استریل کردن خاک و جلوگیری از فرسایش نیز استفاده می‌گردد. اگر چه یون تیوسیانات از مولکول‌های پدید آورنده خود (سیانید) سمیت کم­تری (7-10 برابر) دارد (5) اما با ثبات‌تر بوده و سخت‌تر از بین می‌رود(6). سیانید دارای پتانسیل واکنش آسان با گوگرد برای تولید تیوسیانات می‌باشد؛ بنابراین هر صنعتی که در پساب خود دارای سیانید باشد می‌تواند منبع بالقوه آلودگی تیوسیانات قلمداد شود (5). علی­رغم سمیت کم­تر نسبت به سیانید آزاد، دوز کشنده آن برای انسان 50–80 میلی‌گرم بر کیلوگرم در وزن بدن است و عوارض مزمن بایک دوز روزانه تقریباً 2-12 میلی‌گرم بر کیلوگرم وزن بدن دیده می‌شود (1). اثرات سمی تیوسیانات شامل مهار انتقالات هالید به غده تیروئید، معده، قرنیه و آبشش­ها(در آبزیان) به­علاوه مهارکننده آنزیم­های گوناگون می‌باشد. تیوسیانات روی سیستم عصب مرکزی انسان‌ تأثیر می­گذارد و باعث کج‌خلقی، حالات عصبی، توهم، روان‌پریشی (جنون)، هیجان­های بی‌دلیل و زیاد (عشق و دیوانگی)، هذیان و تشنج می‌شود (1، 7).

همه روش­های حذف تیوسیانات از محیط شامل کلرزنی مستقیم و استفاده از هیپوکلریت، اکسیداسیون پراکسید هیدروژن، اکسیداسیون اوزون، تجزیه الکترولیتیکی و ...  دارای معایبی بوده که بکار گیری آن­ها را در طبیعت محدود کرده است(5،8). به طورکلی دو مسیر شیمی و اتوتروف تجزیه میکروبی تیوسیانات توسط برخی از باکتری‌های هوازی شناسایی شده­اند، که عبارت‌اند از مسیر سیانات (CNO) و مسیرکربونیل سولفید (COS) (به‌عنوان ترکیبات حد واسط)(4).

تجزیه زیستی یکی از روش­های ارزان و موثر در پاک­سازی ترکیبات شیمیایی سمی است. این تکنیک بر پایه فعالیت گونه­های خاصی از میکروارگانیسم­هایی که قادرند ترکیبات شیمیایی سمی را به­طور کامل یا تا قسمتی تجزیه کنند استوار است (9).برخی از میکروارگانیسم‌ها می­توانند تیوسیانات را به‌عنوان منبع انرژی، کربن، نیتروژن یا گوگرد بعد از هیدرولیز آن به سولفید، آمونیاک ودی­اکسیدکربن مصرف کنند (10، 11).

 اهمیت دریاچه‌های آب‌شور مانند مهارلو را می‌توان در سه بخش بهداشتی، اقتصادی و زیست محیطی مورد بررسی قرار داد. از آنجایی که دریاچه مهارلو یکی از منابع تأمین نمک خوراکی و صنعتی می‌باشد حضور آلاینده‌های صنعتی در آب یا رسوبات این دریاچه می‌تواند به‌عنوان تهدید جدی برای سلامتی جامعه مطرح باشد.

Mekutaو همکاران در سال 2014، نشان دادند تمام باکتری­های جداسازی شده از فاضلاب حاوی سیانید به جنس Bacillus تعلق داشتند. درصورت حضور زیاد منبع آمینی، باکتری ابتدا منبع آمینی را بعلت تجزیه آسان مصرف کرده در نتیجه مانع مصرف سیانید در محیط کشت گردید(19). در سال 2016  باکتری Pseudomonas aeruginosa، به عنوان باکتری تجزیه کننده سیانید وتیوسیانات از جایگاه­های نفتی جداسازی شد و میزان رشد و تجزیه سیانید آزاد و تیوسیانات در شرایط قلیایی مورد بررسی قرار گرفت(18).

با توجه به این­که تاکنون مطالعه ای در ارتباط با تجزیه زیستی تیوسیانات توسط میکروارگانسم­های موجود در این دریاچه صورت نگرفته است، هدف از انجام این مطالعه جداسازی و شناسایی باکتری­های تجزیه کننده تیوسیانات از دریاچه مهارلو  می باشد.

روش بررسی

نمونه برداری:  نمونه‌ برداری از رسوبات دریاچه مهارلو در 5 ایستگاه  و دو فصل تابستان و بهار صورت گرفت. در هر ایستگاه از سه نقطه نمونه ‌برداری شد. نقاط نمونه ‌برداری شده با دستگاه جی‌پی‌اس، جهت نمونه ‌برداری فصل بعد ثبت گردید (شکل1). ایستگاه­ها ترجیحاً در مناطقی که احتمال آلودگی بیش­تر داشتند انتخاب شدند و نمونه برداری از رسوبات دریاچه در عمق 0-10 سانتی­متر صورت گرفت. نمونه‌های مورد نظر درون ظرف‌های استریل سربسته روی یخ قرار داده و به آزمایشگاه منتقل شدند.

 

 

 


غنی سازی:

 

جهت غنی سازی باکتری­های تجزیه کننده تیوسیات ازمحیط کشت پایه نمکیM9 مطابق جدول 1استفاده شد.محلول 10 میلی مولار KSCN و گلوکوز (10 میلی‌گرم بر لیتر) با فیلتر استریلیزه(0.2 um pore size) استریل و به محیط کشتM9 اضافه شدند.5 گرم از نمونه رسوب مورد نظر به 50 میلی‌لیتر محیط کشت­های غنی‌سازی شده استریل اضافه و به مدت یک هفته در دمای 30 درجه­سانتی‌گراد و دور rmp150 گرم­خانه گذاریشد. غنی سازی با دوبار تکرارانجام شد(1).

 

 

 

جدول 1 - مواد لازم جهت تهیه محیط M9 در یک لیتر آب دیونیزه

Table 1. Materials for preparation of M9 medium in one liter of deionised water

مواد

K2HPO4

KH2PO4

NaCl

KCl

MgSO4.7H2O

FeSO4.7H2O

مقدار (گرم)

4/3

45/0

5/0

5/0

01/0

 

 


جداسازی و خالص‌سازی باکتریایی:بعد یک هفته گرم­خانه گذاری 100 لاندا محیط کشت­های کدر شده روی محیط‌های نوترینت آگار ریخته و به مدت 72-96 ساعت در دمای 30 درجه سانتی‌گراد در گرمخانه گذاشته شد. پس از چندین بار کشت مرحله­ای، تک کلنی­ها را روی محیط کشت اختصاصی M9 آگار (شامل تیوسیانات و گلوکوز ) کشت داده شدند(1).

شناسایی باکتری­های تجزیه کننده تیوسیانات: ابتدا باکتری­ها بوسیله رنگ آمیزی گرم شناسایی مورفولوژی شدند سپس جهت شناسایی دقیق­تر از تست­های بیوشیمیایی شامل: هیدرولیز آمیلاز، کاتالاز، احیای نیترات، آرابینوز، تخمیر مانیتول، تخمیر گلوکز،سیترات، VP، TSI، OF، SIM استفاده شد.

تعیین حداقل غلظت بازدارندگی رشد باکتری: این تست برای تشخیص باکتری­های دارای بالاترین آستانه تحمل نسبت به تیوسیانات استفاده ­شد. در این تست، از محیطی شفاف با پایه نمکی M9که در هر لیتر آب دیونیزه شامل: 5گرم NaCl، 1­گرم KH2PO4، 1گرم K2HPO4،­ 2/0­ گرم MgSO4.7H2Oاستفاده گردید. برای هر نمونه ده لوله حاوی 1 میلی‌لیتر محیط M9استریل در نظر گرفته شد. محلول پتاسیم تیوسیانات با غلظت 100 گرم در لیتر تهیه گردید و پس از فیلتر کردن آن با فیلتر استریلیزه(0.2 um pore size )، مقدار 1 میلی‌لیتر به آخرین لوله (لوله 10) اضافه شد، سپس 1 میلی‌لیتر آن از لوله10 برداشته و به لوله 9 اضافه شد و این عمل تا لوله 2 تکرار شد. لوله شماره 1 به عنوان  لوله شاهد (بدون تیوسیانات) انتخاب گردید. سوسپانسیون باکتریایی منطبق با نیم مک فارلند به مقدار 50 لاندا به لوله­ها اضاف شد. نمونه­ها به مدت 48 ساعت در دمای 30 درجه سانتی‌گراد گرمخانه گذاری شدند (12 ، 13).

سینتیک رشد باکتری­های مقاوم: در این تست برای هر باکتری 6 ارلن که هرکدام حاوی ترکیب 90 سی‌سی محیط کشتM9با غلظت­های 10,20،30،40،50 ‌گرم در لیتر پتاسیم تیوسیانات تهیه و سپس با فیلتر استریلیزه( 0.2 um pore size ) استریل گردید یکی از ارلن­ها شامل محیط M9، بدون پتاسیم تیوسیانات بعنوان شاهد انتخاب شد. مقدار 10 میلی‌لیتر از سوسپانسیون  منطبق با نیم مک فارلند به ارلن­ها اضافه شد. ارلن­ها در دمای 30 درجه سانتی‌گراد و دور rpm160  به مدت 10 روز گرم­خانه گذاری شدند.هر روز میزان کدورت نمونه‌ها با دستگاه اسپکتوفتومتر نوری(unico Tm1100)با طول‌موج 600 نانومتر، در زمان مشخص خوانده شد (9).

 

ضریب تجزیه زیستی


تیوسیانات: این آزمایش 90 میلی‌لیترM9 و پتاسیم تیوسیانات، به غلظت 10گرم در لیتر تهیه گشت. 10 میلی‌لیتر سوسپانسیون باکتریایی منطبق با نیم مک فارلند به ارلن­­ها افزوده شد. نمونه­ی بدون تلقیح باکتری به‌عنوان شاهد در نظر گرفته شد.پس از یک هفته، مقدار 10 میلی‌لیتر آن را درون لوله فالکون استریل ریخته و با دور 6000 و مدت 15 دقیقه سانتریفیوژ گشت و جهت انجام آنالیز به‌وسیله دستگاه UV visible با طول موج  200-800 نانومترفرستاده شد. میزان تجزیه تیوسیانات به‌وسیله فرمول زیر محاسبه گردید(9).

شناسایی مولکولی:شناسایی مولکولی با استفاده از توالی یابی ژنS rRNA16انجام شد.ابتدا DNAباکتریایی به روش جوشاندن و با دور 12000 به مدت 5 دقیقه سانتریفیوژ شد. محلول حاصله رویی محتویDNA  باکتری، درون میکروتیوپ استریل ریختهشد. میزان کمیت وکیفیت DNA استخراجی توسط دستگاه نانودراپ بررسی شد. برای انجامPCR از دو پرایمرعمومی شامل پرایمر پیش­رو (AGAGTTTGATCCTGGCTCAG) و پرایمر معکوس (GGTTACCTTGTTACGACTT) استفاده شد. مواد جهت PCRدر حجم 25 لاندا که شامل مستر 5/12، پرایمر A و B هر کدام 5/0، آب مقطر تزریقی 5/7 و DNA استخراجی 4 لاندا بود. برنامه دمایی واکنش زنجیره­ای پلیمراز شامل یک چرخه واسرشت اولیه در دمای 95 و در زمان 5 دقیقه، به دنبال آن 30چرخه  تکثیر شامل واسرشت شدن در دمای 95 به مدت 1 دقیقه، اتصال پرایمر در دمای 54 به مدت 1 دقیقه و طویل سازی در دمای72 درجه و در مدت 1 دقیقه و در نهایت یک چرخه طویل سازی نهایی در دمای 72 و مدت 5 دقیقه انجام شد.پس از الکتروفورز باژل آگارز 1%، بوسیله دستگاه ژل داک عکس برداری شد. محصول PCR جهت توالی یابی یک­طرفه به شرکت ماکروژن کره جنوبی فرستاده شد.نمونه‌های تعیین توالی شده با کتابخانه ژنوم مرکز بین‌المللی اطلاعات بیوتکنولوژی (NCBI) مقایسه و بلاست گردید. درخت تبارزایی و ارتباط ژنتیکی بین سویه ها بوسیله نرم افزار Mega7 (ویرایش 7.0.18) رسم شد.

 

 

یافته­ها

جداسازی و شناسایی باکتری­های تجزیه کننده تیوسیانات:در این پژوهش 9گونه باکتریایی تجزیه کننده­ی تیوسیانات از رسوبات دریاچه مهارلو به‌وسیله رنگ‌آمیزی گرم و تست­های بیوشیمیایی شناسایی و جداسازی شدند که شامل باکتری‌هایBacillussphaericus، Bacillus pasteurii، Bacillus azotoformans، Bacillus patothenticus، Bacillus circulans، Micrococcus varians، Micrococcus luteus،B. popilliae، Acinetobacter lowffiبودند.

تعیین حداقل غلظت بازدارندگی رشد باکتری: در تست حداقل غلظت بازدارندگی، باکتریB. sphaericusوM. Luteusدارای بیش­ترین مقاومت بودند. در نتیجه باکتری­های ذکر شده به­عنوان مقاوم­ترین گزینه­ها جهت انجام تست سنتیک رشد و میزان تجزیه زیستی تیوسیانات انتخاب شدند (جدول2). در این مرحله در فصل تابستان باکتری B. sphaericus1 و در فصل بهار B. sphaericus2 وM. luteusبه­عنوان مقاوم­ترین باکتری­های تجزیه کننده تیوسیانات جداسازی شدند.

 


جدول 2- تست حداقل غلظت مهارکنندگی

Table 2.  Minimum inhibitory concentration test

غلظت(گرم در لیتر)

1.56

125/3

25/6

5/12

25

50

بدون باکتری

بدون

 تیوسیانات

B. sphaericus

+

+

+

+

+

-

-

+

B. pasteurii

+

+

+

+

-

-

-

+

B. patothenticus

+

+

-

-

-

-

-

+

B. azotoformans

+

+

+

-

-

-

-

+

B. popilliae

+

+

+

-

-

-

-

+

B. circulans

+

-

-

-

-

-

-

+

M. varians

+

+

+

+

-

-

-

+

M. luteus

+

+

+

+

+

-

-

+

Acinetobacter lowffi

+

+

+

+

-

-

-

+


 


سینتیک رشدباکتری­های مقاوم: در این تست باکتری­های مقاوم پس از 24 ساعت وارد فاز لگاریتمی شدند و در 72 ساعت به اوج رشد خود رسیدند. پس از آن روند نزولی خود را طی کردند. هر دو  باکتریB. sphaericus1 و 2 در 30گرم در لیتر تیوسیانات (نمودار 2و3) و باکتریM. luteus در دو غلظت 20 و30 گرم در لیتر بیش­ترین میزان رشد را نشان دادند(نمودار4).


   
 

 


ضریب تجزیه زیستی تیوسیانات:میزان تجزیه تیوسیانات توسط باکتری‌های مقاوم شاملB. sphaericus 1 ، B. sphaericus 2 و M. luteus به ترتیب برابر با 66/66، 33/43 و 50 درصد بود. بدلیل تجزیه زیر 50 درصد B. sphaericus 2 این باکتری به­عنوان باکتری دارای صلاحیت انتخاب نشد و فقط B. sphaericus 1 و M. luteusدر مرحله بعد شناسایی مولکولی شدند.


   

نمودار 5- منحنی تجزیه تیوسیانات در غلظت 10 گرم در لیتر در نمونه شاهد (بدون تلقیح باکتری)

Figure 5. Tiocyanate decomposition curve at a concentration of 10 g / L in a control sample (without inoculation of bacteria)

نمودار6- منحنی تجزیه تیوسیانات در غلظت 10 گرم در لیتر در B. sphaericus1

Figure 6. Thiocyanate decomposition curve at a concentration of 10 g / L in B. sphaericus1

   

نمودار 7- منحنی تجزیه تیوسیانات در غلظت 10 گرم در لیتر در B. sphaericus2

Figure 7. Thiocyanate decomposition curve at a concentration of 10 g / L in B. sphaericus2

نمودار 8- منحنی تجزیه تیوسیانات در غلظت 10 گرم در لیتر درM.luteus

Figure 8. Thiocyanate decomposition curve at a concentration of 10 g / L in M.luteus

 


شناسایی مولکولی:شکل 9 ژل آگارز محصول PCR باکتری‌های مقاوم را نشان می‌دهد.چاهکM ماکر bp100، چاهک یکM. luteus ، چاهک دو B. sphaericus2، چاهک سه  B. sphaericus1، چاهکN کنترل منفی (بدون DNA) بود (شکل 9).


 

 

نتایج حاصل از بلاست کردن توالی­ها نشان داد باکتریM.luteus با 97 در صد تشابه باPlanococcus citreus strain NBRC 15849وباکتریB. sphaericusوبا 92 درصد تشابه با Bacillus aerius strain 24K همولوژی داشت (شکل 10 و 11).


 

 

 

 

بحث و نتیجه گیری


روش های مختلفی برای پاک­سازی آلاینده­های مختلف وجود دارد که این روش ها در سه دسته کلی فیزیکی، شیمیایی و زیستی دسته بندی می­شود. روش­های زیستی که به طور معمول شامل تبدیل آلودگی ها به مواد غیر سمی، با استفاده از فرایندهای میکروبی است (14)، ضمن سازگاری با محیط زیست، از نظر اقتصادی نیز نسبت به دیگر روش های پاک­سازی برتری دارند (15).

نتایج مطالعه حاضر نشان داد باکتری­های جداسازی شده از رسوبات دریاچه مهارلو (شامل جنس های Bacillus, Micrococos, Acintobacter) دارای پتانسیل حذف این ترکیب سمی می­باشند. در مطالعات مشابه نیز گزارش شده است که جنس های متنوعی از باکتری­ها شامل Bacillus ,Brevibacterium Corynebacterium, Arthrobacter, Escherichia, Meth